LexA | LexA repressor (protein, positive control)

(Cat#: AS21 4541P)
AS21_4541P
AS21_4541P
Description
  • Purity: Contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90% pure by SDS-PAGE.
  • Format: Liquid
  • Quantity: 20 µg
  • Storage: Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
  • Tested applications: Western blot (WB)
  • Confirmed reactivity: 22.3 | 23 kDa
  • Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
  • This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies

Boca Scientific is your premiere source for high-quality, innovative solutions for Cell Biology, Molecular Biology, Immunology, genetics and other lab products and reagents. We bring leading-edge products from our own-line and around the world to laboratories in the US and Canada. Our goal is to offer excellent solutions to drive research and discoveries backed by superior customer support.

Recently Viewed Products